CtNorm: Real time PCR cycle of threshold (Ct) normalization algorithm

In relative quantification with Actual Time PCR (qRT-PCR,), correct evaluation requires equal amplification effectivity for each genes (Gene of curiosity and reference gene) and equal threshold values for all of the samples. On this quantification technique the expression stage in handled samples shall be calculated compared to the management group. We carried out the current examine to design an algorithm for changing the info obtained from totally different runs containing similar customary samples into one run with the identical amplification effectivity and threshold worth.

For this goal, two formulation have been designed; one to transform the amplification effectivity of the every run to 100%, and the opposite one for changing knowledge from totally different runs into one run. Using these two formulation, an algorithm was developed and named CtNorm. The web model of CtNorm algorithm is on the market at http://ctnorm.sums.ac.ir/. We used qRT-PCR method to validate the accuracy of the designed algorithm for the normalization of 4 totally different human inside management genes.

Normalizing the Ct values obtained from separate runs with the CtNorm algorithm has eradicated the variations and the common of the Ct values has change into much like the situation during which all of the samples have been amplified in a single run. The CtNorm algorithm could possibly be utilized for equalizing the Ct values of a number of qRT-PCR runs with the identical customary samples. The algorithm has additionally the flexibility to transform the amplification effectivity to 100% which is helpful in absolute and relative quantification.

cDNA from Human Adult Normal Tissue: Uterus: Cervix
C1234275	Biochain	40 reactions	EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Corpus
C1234276-10	Biochain	10 reactions	EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Fundus
C1234278-10	Biochain	10 reactions	EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix
C1534275	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus: Cervix
C1534275-Cy	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus
C1534276	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus
C1534278	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-48T	DL Develop	48T	EUR 441
Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-96T	DL Develop	96T	EUR 570
Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455

Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629

Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Uterus Tumor lysate
HTL-1384	Alpha Diagnostics	1 mg	EUR 773

Total RNA from Human Adult Normal Tissue: Uterus: Cervix of uterus
R1234275-50	Biochain	50 ug	EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Human Adult Normal Tissue: Uterus: Corpus of Uterus
R1234276-10	Biochain	10 ug	EUR 194
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Lupus: Uterus
R1236274Lup-50	Biochain	50 ug	EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT/ Rat CAT ELISA Kit
ELA-E0242r	Lifescience Market	96 Tests	EUR 886

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Uterus: Cervix of uterus
R1234275-P	Biochain	50 ug	EUR 328
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT siRNA
20-abx900807	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAT siRNA
20-abx910366	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAT siRNA
20-abx910367	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAT Antibody
36312-100ul	SAB	100ul	EUR 252

Cat IgM
31C-CH0213	Fitzgerald	1 mg	EUR 392
Description: Purified Cat IgM

CAT antibody
10R-3584	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody
10R-3585	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CAT antibody

CAT antibody
20C-CR1111RP	Fitzgerald	500 ul	EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody
70R-16187	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody
1-CSB-PA942303	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT Antibody
1-CSB-PA004563GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody
1-CSB-PA004980	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody
1-CSB-PA599838	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody
1-CSB-PA070043	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

pOTB7-CAT
PVT18217	Lifescience Market	2 ug	EUR 231

pCas9- CAT
PVT11001	Lifescience Market	2 ug	EUR 301

Frozen Tissue Section - Human Tumor: Uterus
T1235274	Biochain	5 slides	EUR 338
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Adult Uterus (Normal) Whole tissue lysate
HAL-1317	Alpha Diagnostics	1 mg	EUR 524

FFPE Genomic DNA - Human Tumor Tissue: Uterus
D2235274	Biochain	2 ug	EUR 821
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Monkey (Rhesus) Normal Uterus Whole tissue lysate
MRL-1332	Alpha Diagnostics	1 mg	EUR 773

Total Protein from Human Tumor Tissue: Uterus
P1235274	Biochain	1 mg	EUR 320
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Monkey (Cyno.) Normal Uterus Whole tissue lysate
MCL-1222	Alpha Diagnostics	1 mg	EUR 773

Membrane Protein from Human Tumor Tissue: Uterus
P3235274	Biochain	0.1 mg	EUR 408
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Human Tumor Tissue: Uterus
R1235274-50	Biochain	50 ug	EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Frozen Tissue Section - Human Adult Normal: Uterus
T1234274	Biochain	5 slides	EUR 349
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Adult Normal: Uterus
T2234274	Biochain	5 slides	EUR 211
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Uterus Cervix Tumor
T2235275	Biochain	5 slides	EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

PKA CAT Antibody
AF5450	Affbiotech	200ul	EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody
C36312	SAB	100ul	EUR 397

PKA CAT Antibody
AF7746	Affbiotech	200ul	EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid
CSB-CL004563HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1584 Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG Show more
Description: A cloning plasmid for the CAT gene.

Cat Uromodulin Enzyme
20-abx073947	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	0.1 mg 10 ug 2 µg
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx125619	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx125620	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx111432	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx132110	Abbexa	EUR 272.00 EUR 592.00 EUR 314.00 EUR 154.00 EUR 230.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx132122	Abbexa	EUR 300.00 EUR 718.00 EUR 384.00 EUR 154.00 EUR 244.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx141181	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

PKA CAT Antibody
abx147539-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx148940	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx100146	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100147	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100148	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx100149	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx100150	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
20-abx100151	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Catalase (CAT) Antibody
abx034033-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx034033-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx025488-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx004037	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

PKA CAT Antibody
ABF5450	Lifescience Market	100 ug	EUR 438

Catalase (CAT) Antibody
20-abx175722	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Catalase (CAT) Antibody
20-abx323535	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx326479	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Catalase (CAT) Antibody
20-abx214177	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx430824-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Catalase (CAT) Antibody
20-abx242079	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Catalase (CAT) Antibody
abx231301-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Catalase (CAT) Antibody
20-abx171619	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

CAT Rabbit pAb
A11777-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A11777-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A11777-20ul	Abclonal	20 ul	EUR 183

CAT Rabbit pAb
A11777-50ul	Abclonal	50 ul	EUR 223

CAT Rabbit pAb
A11780-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A11780-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A11780-20ul	Abclonal	20 ul	EUR 183

CAT Rabbit pAb
A11780-50ul	Abclonal	50 ul	EUR 223

Normal Cat Serum
88R-1026	Fitzgerald	10 ml	EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

CAT Rabbit pAb
A5275-100ul	Abclonal	100 ul	EUR 308

CAT Rabbit pAb
A5275-200ul	Abclonal	200 ul	EUR 459

CAT Rabbit pAb
A5275-20ul	Abclonal	20 ul	Ask for price

CAT Rabbit pAb
A5275-50ul	Abclonal	50 ul	Ask for price

b-cat antibody
70R-21460	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal b-cat antibody

Feline Cat IgG
31-1005	Fitzgerald	5 mg	EUR 175
Description: Feline (Cat) IgG Purified-Protein A

Cat RBC antibody
20R-RR015	Fitzgerald	20 mg	EUR 327
Description: Rabbit polyclonal Cat RBC antibody

Cat RBC antibody
20R-RR016	Fitzgerald	5 mg	EUR 554
Description: Rabbit polyclonal Cat RBC antibody

Cat IgG (FITC)
65C-CH0202	Fitzgerald	1 mg	EUR 227
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)
65C-CH0203	Fitzgerald	1 mg	EUR 248
Description: Purified Cat IgG HRP conjugate

Recombinant Human CAT
P0501	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P04040
Description: Recombinant Human protein for CAT

Recombinant Catalase (CAT)
4-RPC418Hu01	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu02	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu03	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Hu04	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04040 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Mu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P24270 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Recombinant Catalase (CAT)
4-RPC418Mu02	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P24270 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli

Rat Catalase (CAT)
QY-E11654	Qayee Biotechnology	96T	EUR 374

pCEP4- CAT Plasmid
PVT1038	Lifescience Market	2 ug	EUR 266

pCMV-SPORT6-CAT
PVT14338	Lifescience Market	2 ug	EUR 495

Anti-CAT antibody
STJ27228	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ113361	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ113364	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Anti-CAT antibody
STJ119991	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.

Catalase (10,000-15,000 U/mg), Bovine Liver
CAT-01	Alpha Diagnostics	25 mU	EUR 529

Catalase (2000-4000 U/mg), Aspergillus Niger
CAT-02	Alpha Diagnostics	25 mU	EUR 651

Catalase (4000-6000 U/mg), Bovine Liver
CAT-03	Alpha Diagnostics	5 mU	EUR 347

Catalase (>40,000 u/mg), Bovine Liver
CAT-04	Alpha Diagnostics	1 mg	EUR 286

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

Human Uterus Tissue Slide (Normal) (5 slides/pk)
HTS-11401	Alpha Diagnostics	1 pk	EUR 286

Human Uterus Tissue Slide (Benign) (5 slides/pk)
HTS-11402	Alpha Diagnostics	1 pk	EUR 286

Human Uterus Tissue Slide (Adenocarcinoma) (5 slides/pk)
HTS-11404	Alpha Diagnostics	1 pk	EUR 286

Human Uterus Tissue Slide (Abnormal) (5 slides/pk)
HTS-11419	Alpha Diagnostics	1 pk	EUR 286

Human Uterus Tissue Slide (Adenomyoma) (5 slides/pk)
HTS-11432	Alpha Diagnostics	1 pk	EUR 286

Total Protein from Human Adult Normal Tissue: Uterus
P1234274	Biochain	1 mg	EUR 214
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Membrane Protein from Human Adult Normal Tissue: Uterus
P3234274	Biochain	0.1 mg	EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Human Adult Normal Tissue: Uterus
R1234274-50	Biochain	50 ug	EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Paraffin Tissue Section - Human Uterus Tumor: Endometrium Adenocarcinoma
T2235274-3	Biochain	5 slides	EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

PKA CAT Blocking Peptide
AF5450-BP	Affbiotech	1mg	EUR 195

Polyclonal CAT / Catalase Antibody
APG02430G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT / Catalase . This antibody is tested and proven to work in the following applications:

Monoclonal CAT / Catalase Antibody
APG02431G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human CAT / Catalase. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P

Recombinant Human Catalase/CAT
CE86-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT
CE86-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT
CE86-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Catalase/CAT
CE86-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Rat Catalase (CAT) Protein
20-abx652798	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Polyclonal CAT Antibody (Center)
APR07030G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT (Center). This antibody is tested and proven to work in the following applications:

CAT Polyclonal Conjugated Antibody
C30258	SAB	100ul	EUR 397

Rat CAT shRNA Plasmid
20-abx984402	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.