CtNorm: Real time PCR cycle of threshold (Ct) normalization algorithm

CtNorm: Actual time PCR cycle of threshold (Ct) normalization algorithm

In relative quantification with Actual Time PCR (qRT-PCR,), correct evaluation requires equal amplification effectivity for each genes (Gene of curiosity and reference gene) and equal threshold values for all of the samples. On this quantification technique the expression stage in handled samples shall be calculated compared to the management group. We carried out the current examine to design an algorithm for changing the info obtained from totally different runs containing similar customary samples into one run with the identical amplification effectivity and threshold worth.
For this goal, two formulation have been designed; one to transform the amplification effectivity of the every run to 100%, and the opposite one for changing knowledge from totally different runs into one run. Using these two formulation, an algorithm was developed and named CtNorm. The web model of CtNorm algorithm is on the market at http://ctnorm.sums.ac.ir/. We used qRT-PCR method to validate the accuracy of the designed algorithm for the normalization of 4 totally different human inside management genes.
Normalizing the Ct values obtained from separate runs with the CtNorm algorithm has eradicated the variations and the common of the Ct values has change into much like the situation during which all of the samples have been amplified in a single run. The CtNorm algorithm could possibly be utilized for equalizing the Ct values of a number of qRT-PCR runs with the identical customary samples. The algorithm has additionally the flexibility to transform the amplification effectivity to 100% which is helpful in absolute and relative quantification.
russelldurrett
russelldurrett
cDNA from Human Adult Normal Tissue: Uterus: Cervix
C1234275 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Human Adult Normal Tissue: Uterus: Corpus
C1234276-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Human Adult Normal Tissue: Uterus: Fundus
C1234278-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix
C1534275 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus: Cervix
C1534275-Cy 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus
C1534276 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus
C1534278 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-48T 48T
EUR 441
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Catalase (CAT) ELISA Kit
DLR-CAT-Hu-96T 96T
EUR 570
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-48T 48T
EUR 527
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Catalase (CAT) ELISA Kit
DLR-CAT-Mu-96T 96T
EUR 688
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-48T 48T
EUR 549
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Catalase (CAT) ELISA Kit
DLR-CAT-Ra-96T 96T
EUR 718
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-48Tests 48 Tests
EUR 436
Human Catalase (CAT) ELISA Kit
RD-CAT-Hu-96Tests 96 Tests
EUR 601
Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-48Tests 48 Tests
EUR 533
Mouse Catalase (CAT) ELISA Kit
RD-CAT-Mu-96Tests 96 Tests
EUR 740
Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-48Tests 48 Tests
EUR 557
Rat Catalase (CAT) ELISA Kit
RD-CAT-Ra-96Tests 96 Tests
EUR 775
Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-48Tests 48 Tests
EUR 455
Human Catalase (CAT) ELISA Kit
RDR-CAT-Hu-96Tests 96 Tests
EUR 629
Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-48Tests 48 Tests
EUR 557
Mouse Catalase (CAT) ELISA Kit
RDR-CAT-Mu-96Tests 96 Tests
EUR 774
Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-48Tests 48 Tests
EUR 583
Rat Catalase (CAT) ELISA Kit
RDR-CAT-Ra-96Tests 96 Tests
EUR 811
Human Uterus Tumor lysate
HTL-1384 1 mg
EUR 773
Total RNA from Human Adult Normal Tissue: Uterus: Cervix of uterus
R1234275-50 50 ug
EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
Total RNA from Human Adult Normal Tissue: Uterus: Corpus of Uterus
R1234276-10 10 ug
EUR 194
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
Total RNA from Lupus: Uterus
R1236274Lup-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
CAT/ Rat CAT ELISA Kit
ELA-E0242r 96 Tests
EUR 886
Total RNA from Human Adult Normal Tissue 5 Donor Pool: Uterus: Cervix of uterus
R1234275-P 50 ug
EUR 328
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
CAT siRNA
20-abx900807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CAT siRNA
20-abx910366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CAT siRNA
20-abx910367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CAT Antibody
36312-100ul 100ul
EUR 252
Cat IgM
31C-CH0213 1 mg
EUR 392
Description: Purified Cat IgM
CAT antibody
10R-3584 100 ul
EUR 726
Description: Mouse monoclonal CAT antibody
CAT antibody
10R-3585 100 ul
EUR 691
Description: Mouse monoclonal CAT antibody
CAT antibody
20C-CR1111RP 500 ul
EUR 262
Description: Rabbit polyclonal CAT antibody
CAT antibody
70R-16187 50 ul
EUR 435
Description: Rabbit polyclonal CAT antibody
CAT Antibody
1-CSB-PA942303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
CAT Antibody
1-CSB-PA004563GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CAT Antibody
1-CSB-PA004980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
CAT Antibody
1-CSB-PA599838
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
CAT Antibody
1-CSB-PA070043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000
pOTB7-CAT
PVT18217 2 ug
EUR 231
pCas9- CAT
PVT11001 2 ug
EUR 301
Frozen Tissue Section - Human Tumor: Uterus
T1235274 5 slides
EUR 338
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Evo? cDNA Kit
M1164-100
EUR 294
Evo? cDNA Kit
M1164-25
EUR 234
Novo? cDNA Kit
M1165-100
EUR 354
Novo? cDNA Kit
M1165-25
EUR 267
Evo? cDNA Supermix
M1168-100
EUR 381
Evo? cDNA Supermix
M1168-25
EUR 267
Novo? cDNA Supermix
M1169-100
EUR 441
Novo? cDNA Supermix
M1169-25
EUR 289
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Human Adult Uterus (Normal) Whole tissue lysate
HAL-1317 1 mg
EUR 524
FFPE Genomic DNA - Human Tumor Tissue: Uterus
D2235274 2 ug
EUR 821
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Monkey (Rhesus) Normal Uterus Whole tissue lysate
MRL-1332 1 mg
EUR 773
Total Protein from Human Tumor Tissue: Uterus
P1235274 1 mg
EUR 320
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Monkey (Cyno.) Normal Uterus Whole tissue lysate
MCL-1222 1 mg
EUR 773
Membrane Protein from Human Tumor Tissue: Uterus
P3235274 0.1 mg
EUR 408
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Total RNA from Human Tumor Tissue: Uterus
R1235274-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
Frozen Tissue Section - Human Adult Normal: Uterus
T1234274 5 slides
EUR 349
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section - Human Adult Normal: Uterus
T2234274 5 slides
EUR 211
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section - Human Uterus Cervix Tumor
T2235275 5 slides
EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
PKA CAT Antibody
AF5450 200ul
EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.
CAT Conjugated Antibody
C36312 100ul
EUR 397
PKA CAT Antibody
AF7746 200ul
EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.
CAT cloning plasmid
CSB-CL004563HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.
Cat Uromodulin Enzyme
20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx125619
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx125620
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx111432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx132110
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • EUR 154.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Catalase (CAT) Antibody
20-abx132122
  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Catalase (CAT) Antibody
20-abx141181
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
PKA CAT Antibody
abx147539-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx148940
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx100146
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Catalase (CAT) Antibody
20-abx100147
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Catalase (CAT) Antibody
20-abx100148
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Catalase (CAT) Antibody
20-abx100149
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Catalase (CAT) Antibody
20-abx100150
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Catalase (CAT) Antibody
20-abx100151
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Catalase (CAT) Antibody
abx034033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
abx034033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
abx025488-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx004037
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
PKA CAT Antibody
ABF5450 100 ug
EUR 438
Catalase (CAT) Antibody
20-abx175722
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Catalase (CAT) Antibody
20-abx323535
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx326479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
20-abx214177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
abx430824-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Catalase (CAT) Antibody
20-abx242079
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Catalase (CAT) Antibody
abx231301-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Catalase (CAT) Antibody
20-abx171619
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
CAT Rabbit pAb
A11777-100ul 100 ul
EUR 308
CAT Rabbit pAb
A11777-200ul 200 ul
EUR 459
CAT Rabbit pAb
A11777-20ul 20 ul
EUR 183
CAT Rabbit pAb
A11777-50ul 50 ul
EUR 223
CAT Rabbit pAb
A11780-100ul 100 ul
EUR 308
CAT Rabbit pAb
A11780-200ul 200 ul
EUR 459
CAT Rabbit pAb
A11780-20ul 20 ul
EUR 183
CAT Rabbit pAb
A11780-50ul 50 ul
EUR 223
Normal Cat Serum
88R-1026 10 ml
EUR 250
Description: Normal Cat Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
CAT Rabbit pAb
A5275-100ul 100 ul
EUR 308
CAT Rabbit pAb
A5275-200ul 200 ul
EUR 459
CAT Rabbit pAb
A5275-20ul 20 ul Ask for price
CAT Rabbit pAb
A5275-50ul 50 ul Ask for price
b-cat antibody
70R-21460 50 ul
EUR 435
Description: Rabbit polyclonal b-cat antibody
Feline Cat IgG
31-1005 5 mg
EUR 175
Description: Feline (Cat) IgG Purified-Protein A
Cat RBC antibody
20R-RR015 20 mg
EUR 327
Description: Rabbit polyclonal Cat RBC antibody
Cat RBC antibody
20R-RR016 5 mg
EUR 554
Description: Rabbit polyclonal Cat RBC antibody
Cat IgG (FITC)
65C-CH0202 1 mg
EUR 227
Description: Purified Cat IgG FITC conjugate
Cat IgG (HRP)
65C-CH0203 1 mg
EUR 248
Description: Purified Cat IgG HRP conjugate
Recombinant Human CAT
P0501 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P04040
Description: Recombinant Human protein for CAT
Recombinant Catalase (CAT)
4-RPC418Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli
Recombinant Catalase (CAT)
4-RPC418Hu02
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli
Recombinant Catalase (CAT)
4-RPC418Hu03
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli
Recombinant Catalase (CAT)
4-RPC418Hu04
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04040
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Catalase expressed in: E.coli
Recombinant Catalase (CAT)
4-RPC418Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli
Recombinant Catalase (CAT)
4-RPC418Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24270
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Catalase expressed in: E.coli
Rat Catalase (CAT)
QY-E11654 96T
EUR 374
pCEP4- CAT Plasmid
PVT1038 2 ug
EUR 266
pCMV-SPORT6-CAT
PVT14338 2 ug
EUR 495
Anti-CAT antibody
STJ27228 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.
Anti-CAT antibody
STJ113361 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.
Anti-CAT antibody
STJ113364 100 µl
EUR 277
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.
Anti-CAT antibody
STJ119991 100 µl
EUR 413
Description: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene.
Catalase (10,000-15,000 U/mg), Bovine Liver
CAT-01 25 mU
EUR 529
Catalase (2000-4000 U/mg), Aspergillus Niger
CAT-02 25 mU
EUR 651
Catalase (4000-6000 U/mg), Bovine Liver
CAT-03 5 mU
EUR 347
Catalase (>40,000 u/mg), Bovine Liver
CAT-04 1 mg
EUR 286
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415
Novo? Transcriptome cDNA Kit
M1167-100
EUR 952
Novo? Transcriptome cDNA Kit
M1167-25
EUR 441
Human Uterus Tissue Slide (Normal) (5 slides/pk)
HTS-11401 1 pk
EUR 286
Human Uterus Tissue Slide (Benign) (5 slides/pk)
HTS-11402 1 pk
EUR 286
Human Uterus Tissue Slide (Adenocarcinoma) (5 slides/pk)
HTS-11404 1 pk
EUR 286
Human Uterus Tissue Slide (Abnormal) (5 slides/pk)
HTS-11419 1 pk
EUR 286
Human Uterus Tissue Slide (Adenomyoma) (5 slides/pk)
HTS-11432 1 pk
EUR 286
Total Protein from Human Adult Normal Tissue: Uterus
P1234274 1 mg
EUR 214
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Membrane Protein from Human Adult Normal Tissue: Uterus
P3234274 0.1 mg
EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Total RNA from Human Adult Normal Tissue: Uterus
R1234274-50 50 ug
EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.
Paraffin Tissue Section - Human Uterus Tumor: Endometrium Adenocarcinoma
T2235274-3 5 slides
EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
PKA CAT Blocking Peptide
AF5450-BP 1mg
EUR 195
Polyclonal CAT / Catalase Antibody
APG02430G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT / Catalase . This antibody is tested and proven to work in the following applications:
Monoclonal CAT / Catalase Antibody
APG02431G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human CAT / Catalase. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P
Recombinant Human Catalase/CAT
CE86-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Catalase/CAT
CE86-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Catalase/CAT
CE86-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Catalase/CAT
CE86-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Rat Catalase (CAT) Protein
20-abx652798
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Polyclonal CAT Antibody (Center)
APR07030G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAT (Center). This antibody is tested and proven to work in the following applications:
CAT Polyclonal Conjugated Antibody
C30258 100ul
EUR 397
Rat CAT shRNA Plasmid
20-abx984402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Enchancment of pneumococcal pneumonia prognosis utilizing quantitative real-time PCR concentrating on lytA in grownup sufferers: A potential cohort examine

Aims: The intention of the examine was to evaluate the efficiency of real-time polymerase chain response (PCR) concentrating on the lytA gene (rtPCR-lytA) in plasma, urine and nasopharyngeal (NP) samples for the prognosis of pneumococcal community-acquired pneumonia (P-CAP).
Strategies: Potential observational examine together with all consecutive grownup CAP sufferers from November 2015 to Could 2017. P-CAP was outlined if pneumococcus was recognized utilizing typical strategies (CM) and/or a optimistic rtPCR-lytA was detected in blood, urine or NP samples (NP cut-off ≥8000 copies/mL). Diagnostic efficiency of every check was calculated.
Outcomes: 133 CAP sufferers have been included. Of those, P-CAP was identified in 62 circumstances (46.6%). The proportion of P-CAP identified by rtPCR-lytA strategies was considerably larger than by CM (87.1% vs 59.7%, p=0.005). RtPCR-lytA recognized S. pneumoniae in 25 sufferers (40.3% of all P-CAP circumstances) whose prognosis would have been missed by CM. NP-rtPCR-lytA allowed diagnosing 62.3% of P-CAP. A nasopharyngeal colonisation density ≥2351 copies/mL predicted P-CAP prognosis (AUC=0.82, sensitivity=83.3%, specificity=80.9%). There was a optimistic correlation between growing bacterial load in blood and CURB65 (Spearman correlation coefficient r=0.4, p=0.001), PSI (r=0.3, p=0.02), and time to scientific stability (r=0.33, p=0.01). Median bacterial load in blood was larger in P-CAP sufferers with bacteraemia (0.65×103 vs 0x103 copies/mL, p=0.002), ICU admission (0.68×103 vs 0x103 copies/mL, p=0.04) or mechanical air flow (7.45×103 vs 0x103 copies/mL, p=0.04).
Conclusions: The usage of rtPCR-lytA strategies considerably elevated the prognosis of P-CAP as in comparison with CM. Nasopharyngeal swabs rtPCR-lytA detection, with an correct cut-off worth, was essentially the most promising amongst molecular strategies for the prognosis of P-CAP.

Epidemiology and scientific options of intestinal protozoan infections detected by Actual-Time PCR in non-native kids inside an Italian tertiary care kids’s hospital: a cross-sectional examine

Background: Enteric parasite infections are underestimated because of the restricted sensitivity and specificity of microscopy, which stays the diagnostic gold customary in routine scientific apply. This could possibly be a serious drawback in high-income nations, the place the burden of parasitic illnesses is low. Lately, Multiplex Actual-Time polymerase chain response (RT-PCR) primarily based strategies have been applied. Due to this fact, the intention of this examine was to judge the prevalence of 4 enteric protozoan species detected by RT-PCR in non-native kids in Italy, and to explain their scientific traits.
Strategies: Adopted and immigrant kids, evaluated for migration well being evaluation between 2017 and 2020 in a tertiary care kids’s hospital in Italy, have been enrolled. Molecular evaluation for Giardia lamblia, Dientamoeba fragilis, Blastocystis hominis, and Entamoeba histolytica, was carried out by in-house RT-PCR.
Outcomes: Total, 209 kids have been enrolled and 70% of them resulted optimistic by RT-PCR for no less than one enteric parasite. B. hominis (47.8%) was essentially the most generally recognized protozoa, adopted by D. fragilis (44.5%). Co-infections with a number of pathogens have been detected in 35.4% of the samples. Nearly 80% of parasite-positive kids have been asymptomatic and the most typical symptom was flatulence (60.7% of symptomatic kids). Eosinophils have been considerably elevated in RT-PCR optimistic kids in comparison with the detrimental ones and youngsters with D. fragilis offered the very best eosinophils rely.
Conclusions: The In-house Multiplex RT-PCR assay gives a sound molecular detection system for chosen enteric parasites. This novel and correct diagnostic technique might help in growing the detection price of parasite an infection, particularly in high-risk inhabitants.

Novel common primer-pentaplex PCR assay primarily based on chimeric primers for simultaneous detection of 5 widespread pig viruses related to diarrhea

Viral pathogens related to diarrhea in pigs embody porcine circovirus 2 (PCV2), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine rotavirus A (RVA) and C (RVC) amongst others. On this examine, a novel common primer-based pentaplex PCR (UP-M-PCR) assay was developed for simultaneous detection and differentiation of those 5 viruses.
The assay makes use of a short-cycle multiplex amplification by chimeric primers (CP), that are virus particular, with a tail added on the 5′ finish of the common primer (UP), adopted by common amplification utilizing UPs and a common cycle amplification. 5 common primers with CPs (UP1-5) have been designed and evaluated in an UP-based single PCR (UP-S-PCR). All 5 UPs have been discovered to work effectively and UP2 exhibited the most effective efficiency.
After system optimizations, the analytical sensitivity of the UP-M-PCR, utilizing plasmids containing the particular viral goal fragments, was 5 copies/response for every of the 5 viruses regardless of presence of a single or a number of viruses within the template. No cross-reaction was noticed with different non-target viruses. When 273 fecal samples from clinically wholesome pigs have been examined, the assay sensitivity was 90.9-100%, the specificity was 98.0-100%, and the settlement price with the UP-S-PCR was 98.5-99.6% with a Kappa worth being 0.95-0.98. In abstract, the UP-M-PCR developed here’s a fast and extremely delicate and particular detection technique that can be utilized to reveal combined infections in pigs with diarrhea.
SLC52A1 Antibody
1-CSB-PA878904LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
SLC52A1 Antibody
1-CSB-PA281418
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
SLC52A1 Antibody
1-CSB-PA030173
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
SLC52A1 Conjugated Antibody
C37605 100ul
EUR 397
SLC52A1 Antibody (HRP)
20-abx311449
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC52A1 Antibody (FITC)
20-abx311450
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC52A1 Antibody (Biotin)
20-abx311451
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC52A1 Polyclonal Antibody
A67622 100 µg
EUR 570.55
Description: fast delivery possible
SLC52A1 siRNA
20-abx934068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC52A1 Antibody, HRP conjugated
1-CSB-PA878904LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC52A1 Antibody, FITC conjugated
1-CSB-PA878904LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC52A1 Antibody, Biotin conjugated
1-CSB-PA878904LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC52A1. Recognizes SLC52A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SLC52A1 Polyclonal Antibody, HRP Conjugated
A67623 100 µg
EUR 570.55
Description: reagents widely cited
SLC52A1 Polyclonal Antibody, FITC Conjugated
A67624 100 µg
EUR 570.55
Description: Ask the seller for details
SLC52A1 Polyclonal Antibody, Biotin Conjugated
A67625 100 µg
EUR 570.55
Description: The best epigenetics products
Human SLC52A1 shRNA Plasmid
20-abx960440
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC52A1 Recombinant Protein (Human)
RP097485 100 ug Ask for price
SLC52A1 ORF Vector (Human) (pORF)
ORF032496 1.0 ug DNA Ask for price
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
Solute Carrier Family 52 Member 1 (SLC52A1) Antibody
20-abx211053
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Solute Carrier Family 52 Member 1 (SLC52A1) Antibody
20-abx211054
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Solute Carrier Family 52 Member 1 (SLC52A1) Antibody
20-abx324146
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Solute Carrier Family 52 Member 1 (SLC52A1) Antibody
20-abx302068
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC52A1 Protein Vector (Human) (pPB-C-His)
PV129982 500 ng Ask for price
SLC52A1 Protein Vector (Human) (pPB-N-His)
PV129983 500 ng Ask for price
SLC52A1 Protein Vector (Human) (pPM-C-HA)
PV129984 500 ng Ask for price
SLC52A1 Protein Vector (Human) (pPM-C-His)
PV129985 500 ng Ask for price
Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.
Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.
Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277
Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.
Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277
Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277
Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277
Anti-Anti-SEPT11 Antibody antibody
STJ113941 100 µl
EUR 277
Anti-Anti-SEPT11 Antibody antibody
STJ114081 100 µl
EUR 277
Anti-Anti-SEPT5 Antibody antibody
STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-MARCH8 Antibody antibody
STJ114828 100 µl
EUR 277
Anti-Anti-SEPT7 Antibody antibody
STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-SEPT8 Antibody antibody
STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT12 Antibody antibody
STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-MARCH6 Antibody antibody
STJ118549 100 µl
EUR 277
Anti-Anti-MARCH6 Antibody antibody
STJ118550 100 µl
EUR 277
Anti-Anti-MARCH7 Antibody antibody
STJ118752 100 µl
EUR 277
Anti-Anti-SEPT3 Antibody antibody
STJ118990 100 µl
EUR 277
Anti-Anti-SEPT1 antibody antibody
STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Anti-Anti-DDB1 Antibody
A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Anti-CYFIP2 Antibody
A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.
Anti-GPS2 Antibody
A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.
Anti-PRKX Antibody
A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-PPA2 Antibody
A06587 100ug/vial
EUR 294
Anti-GluR8 Antibody
A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-EDG7 Antibody
A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-KIR2.3 Antibody
A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.
Anti-GALK1 Antibody
A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-PRAME Antibody
A06628-2 100ug/vial
EUR 294
Anti-GP2 Antibody
A06630-1 100ug/vial
EUR 334
Anti-USP21 Antibody
A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-TLK2 Antibody
A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.
Anti-PPP1R3C Antibody
A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.
Anti-LRRK1 Antibody
A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.
Anti-MNDA Antibody
A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.
Anti-KAL1 Antibody
A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.
Anti-COL14A1 Antibody
A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.
Anti-CYP4B1 Antibody
A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.
Anti-RFX2 Antibody
A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.
Anti-GPR92 Antibody
A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.
Anti-MBTPS1 Antibody
A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-PLA2G1B Antibody
A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.
Anti-GNB5 Antibody
A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.
Anti-BAIAP2L1 Antibody
A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.
Anti-IRTKS Antibody
A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.
Anti-MLF1 Antibody
A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.
Anti-NDR2 Antibody
A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.
Anti-LARG Antibody
A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.
Anti-GAS1 Antibody
A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.
Anti-APLF Antibody
A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.
Anti-PKCB1 Antibody
A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.
Anti-DnaJB4 Antibody
A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.
Anti-ArfGAP3 Antibody
A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.
Anti-SCN2B Antibody
A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.
Anti-CD316 Antibody
A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.
Anti-AMOTL2 Antibody
A06852 100ug/vial
EUR 294
Anti-POM121 Antibody
A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-TBX22 Antibody
A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.
Anti-QORX Antibody
A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.
Anti-ADAM28 Antibody
A06873-1 100ug/vial
EUR 294
Anti-Adam28 Antibody
A06873-2 100ug/vial
EUR 334
Anti-KSR2 Antibody
A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.
Anti-Recoverin Antibody
A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.
Anti-CRP1 Antibody
A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-CD297 Antibody
A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.
Anti-TAF12 Antibody
A06944-1 100ug/vial
EUR 334
Anti-AKR7A2 Antibody
A06949-1 100ug/vial
EUR 334
Anti-IPMK Antibody
A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-ARHGEF10 Antibody
A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.
Anti-BMP10 Antibody
A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.
Anti-SGK269 Antibody
A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.
Anti-MAST205 Antibody
A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.
Anti-TFF2 Antibody
A07013-1 100ug/vial
EUR 334
Anti-TFF2 Antibody
A07013-2 100ug/vial
EUR 334
Anti-FOXK1 Antibody
A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.
Anti-CD158z Antibody
A07017 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD158z Antibody (KIR3DL3) detection.tested for IHC, WB in Human.
Anti-TSEN54 Antibody
A07022 100ul
EUR 397
Description: Rabbit Polyclonal TSEN54 Antibody. Validated in IHC, WB and tested in Human, Mouse.
Anti-SAR1B Antibody
A07030 100ul
EUR 397
Description: Rabbit Polyclonal SAR1B Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-Peropsin Antibody
A07038 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Peropsin Antibody (RRH) detection. Tested with WB in Human.
Anti-RALY Antibody
A07043 100ul
EUR 397
Description: Rabbit Polyclonal RALY Antibody. Validated in WB and tested in Human.
Anti-Raly Antibody
A07043-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Raly Antibody (RALY) detection. Tested with WB in Human, Mouse, Rat.
Anti-Osteoglycin Antibody
A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.
Anti-APC10 Antibody
A07065-1 100ug
EUR 455
Description: Rabbit Polyclonal APC10 Antibody. Validated in IP, WB and tested in Human.
Anti-RRBP1 Antibody
A07074-1 100ug/vial
EUR 334
Anti-DGKH Antibody
A07077-1 100ul
EUR 397
Description: Rabbit Polyclonal DGKH Antibody. Validated in IF, IHC and tested in Human, Mouse.
Anti-NUP93 Antibody
A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-RBM20 Antibody
A07094 100ug/200ul
EUR 397
Description: Goat Polyclonal RBM20 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-RhoH Antibody
A07101 100ul
EUR 397
Description: Rabbit Polyclonal RhoH Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-ZNF265 Antibody
A07103 100ul
EUR 397
Description: Rabbit Polyclonal ZNF265 Antibody. Validated in IF, WB and tested in Human.
Anti-ZIS Antibody
A07103-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZIS Antibody (ZRANB2) detection.tested for WB in Human, Mouse, Rat.
Anti-BCAS3 Antibody
A07120 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BCAS3 Antibody (BCAS3) detection. Tested with WB in Human, Mouse.
Anti-TAF3 Antibody
A07129 100ul
EUR 397
Description: Rabbit Polyclonal TAF3 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-TIMP4 Antibody
A07131 100ug/vial
EUR 334

Leave a Reply

Your email address will not be published. Required fields are marked *